Computational Biology for Beginners
Week 1 - The Basics

BLAST

Complete & Continue Next Lesson Learn More

LESSON

Understanding and Using BLAST

Objective:

Students will learn about BLAST (Basic Local Alignment Search Tool), its importance in bioinformatics, and how to use it to compare DNA sequences.

Materials:

  • Internet access for online BLAST tool
  • Sample DNA sequences for the activity

1. Introduction to BLAST

What is BLAST?

  • Definition: BLAST is a tool that finds regions of local similarity between sequences. It compares nucleotide or protein sequences to sequence databases and calculates the statistical significance.
  • Purpose: Identifying sequences, finding functional and evolutionary relationships, and predicting the function of novel sequences.

Types of BLAST

  • BLASTN: Nucleotide sequence against nucleotide database.
  • BLASTP: Protein sequence against protein database.
  • BLASTX: Translates a nucleotide sequence to a protein sequence and searches it against a protein database.
  • TBLASTN: Protein sequence against translated nucleotide database.
  • TBLASTX: Translated nucleotide sequence against translated nucleotide database.

Applications of BLAST

  • Gene Identification: Finding genes in different organisms.
  • Functional Prediction: Predicting the function of unknown genes by finding similar known sequences.
  • Evolutionary Studies: Understanding evolutionary relationships between organisms.

2. How to use BLAST

Using BLAST

  1. Access the Tool: Go to the NCBI BLAST website.
  2. Input Sequence: Input a DNA sequence into the BLASTN tool.
  • Do this by entering a FASTA sequence in the box on the top left of the scree
  1. Choose Database: Select a database to search against (e.g., nr/nt, RefSeq).
  2. Run BLAST: Click the BLAST button to start the search.
  3. Interpret Results: Explain how to read the results, focusing on:
    • Score and E-value: Indicating the significance of the match.
    • Alignment: Highlighting similar regions between query and database sequences.
    • Description: Summarizing the matches found.

Example: Use a simple example sequence to show how BLAST identifies similar sequences and what the results indicate.

3. Hands-On Activity: BLAST Search

Activity Instructions:

  1. Access BLAST: Go to the NCBI BLAST website.
  2. Input Sequence:Input your sample DNA sequence into the BLASTN tool. Sample - ttgaatacttaattccactttcaat
  3. Select Database: Choose the appropriate database to search against.
  4. Run BLAST: Start the search and wait for the results.
  5. Analyze Results: Review results, focusing on:
    • The top matches found.
    • The score and E-value of the matches.
    • Any known functions or annotations of the matched sequences.

4. Discussion

Discussion Questions:

  • What did you find interesting or surprising about your BLAST results?
  • How can BLAST be useful in real-world biological research?
  • What challenges did you encounter while using the tool?

5. Wrap-Up and Homework

Wrap-Up:

  • Summarize key points about what BLAST is and how it is used.
  • Emphasize the importance of sequence alignment in understanding biological functions and relationships.

Homework Assignment:

  • Research Project: Find a recent scientific study that used BLAST in their research. Write a brief summary (1-2 paragraphs) of how BLAST was used and what the researchers discovered.